ID: 1201713124

View in Genome Browser
Species Human (GRCh38)
Location Y:17013808-17013830
Sequence TTTTTTTTTTTTTTTTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496384
Summary {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201713124_1201713125 27 Left 1201713124 Y:17013808-17013830 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201713124 Original CRISPR TTTTTTTTTTTTTTTTGAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr