ID: 1201713124 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:17013808-17013830 |
| Sequence | TTTTTTTTTTTTTTTTGAGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 496384 | |||
| Summary | {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201713124_1201713125 | 27 | Left | 1201713124 | Y:17013808-17013830 | CCGTCTCAAAAAAAAAAAAAAAA | 0: 83672 1: 60776 2: 74199 3: 114646 4: 163091 |
||
| Right | 1201713125 | Y:17013858-17013880 | ATATCCTCCAAGAAGAGAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201713124 | Original CRISPR | TTTTTTTTTTTTTTTTGAGA CGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||