ID: 1201713125

View in Genome Browser
Species Human (GRCh38)
Location Y:17013858-17013880
Sequence ATATCCTCCAAGAAGAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201713124_1201713125 27 Left 1201713124 Y:17013808-17013830 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201713125 Original CRISPR ATATCCTCCAAGAAGAGAGA AGG Intergenic
No off target data available for this crispr