ID: 1201717012

View in Genome Browser
Species Human (GRCh38)
Location Y:17056118-17056140
Sequence AATTTGCTTAACCACATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201717012_1201717016 15 Left 1201717012 Y:17056118-17056140 CCTACCATGTGGTTAAGCAAATT No data
Right 1201717016 Y:17056156-17056178 TGTAGTTGTTGAGTGAACTTGGG No data
1201717012_1201717015 14 Left 1201717012 Y:17056118-17056140 CCTACCATGTGGTTAAGCAAATT No data
Right 1201717015 Y:17056155-17056177 CTGTAGTTGTTGAGTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201717012 Original CRISPR AATTTGCTTAACCACATGGT AGG (reversed) Intergenic
No off target data available for this crispr