ID: 1201717015

View in Genome Browser
Species Human (GRCh38)
Location Y:17056155-17056177
Sequence CTGTAGTTGTTGAGTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201717013_1201717015 10 Left 1201717013 Y:17056122-17056144 CCATGTGGTTAAGCAAATTTATA No data
Right 1201717015 Y:17056155-17056177 CTGTAGTTGTTGAGTGAACTTGG No data
1201717010_1201717015 27 Left 1201717010 Y:17056105-17056127 CCAAAAAAGAGATCCTACCATGT No data
Right 1201717015 Y:17056155-17056177 CTGTAGTTGTTGAGTGAACTTGG No data
1201717012_1201717015 14 Left 1201717012 Y:17056118-17056140 CCTACCATGTGGTTAAGCAAATT No data
Right 1201717015 Y:17056155-17056177 CTGTAGTTGTTGAGTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201717015 Original CRISPR CTGTAGTTGTTGAGTGAACT TGG Intergenic
No off target data available for this crispr