ID: 1201719156

View in Genome Browser
Species Human (GRCh38)
Location Y:17078159-17078181
Sequence TCCCTGTGTCTCCACTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201719156_1201719161 23 Left 1201719156 Y:17078159-17078181 CCTGCACAGTGGAGACACAGGGA No data
Right 1201719161 Y:17078205-17078227 CAGAAAGTGTGTGCTGTATAAGG No data
1201719156_1201719159 -5 Left 1201719156 Y:17078159-17078181 CCTGCACAGTGGAGACACAGGGA No data
Right 1201719159 Y:17078177-17078199 AGGGAGCATGTCCTGCACAGGGG No data
1201719156_1201719158 -6 Left 1201719156 Y:17078159-17078181 CCTGCACAGTGGAGACACAGGGA No data
Right 1201719158 Y:17078176-17078198 CAGGGAGCATGTCCTGCACAGGG No data
1201719156_1201719157 -7 Left 1201719156 Y:17078159-17078181 CCTGCACAGTGGAGACACAGGGA No data
Right 1201719157 Y:17078175-17078197 ACAGGGAGCATGTCCTGCACAGG No data
1201719156_1201719162 24 Left 1201719156 Y:17078159-17078181 CCTGCACAGTGGAGACACAGGGA No data
Right 1201719162 Y:17078206-17078228 AGAAAGTGTGTGCTGTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201719156 Original CRISPR TCCCTGTGTCTCCACTGTGC AGG (reversed) Intergenic
No off target data available for this crispr