ID: 1201719158

View in Genome Browser
Species Human (GRCh38)
Location Y:17078176-17078198
Sequence CAGGGAGCATGTCCTGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201719156_1201719158 -6 Left 1201719156 Y:17078159-17078181 CCTGCACAGTGGAGACACAGGGA No data
Right 1201719158 Y:17078176-17078198 CAGGGAGCATGTCCTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201719158 Original CRISPR CAGGGAGCATGTCCTGCACA GGG Intergenic