ID: 1201719160

View in Genome Browser
Species Human (GRCh38)
Location Y:17078188-17078210
Sequence TTTCTGTTTCTCCCCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201719160_1201719164 24 Left 1201719160 Y:17078188-17078210 CCTGCACAGGGGAGAAACAGAAA No data
Right 1201719164 Y:17078235-17078257 CAGAAGTGTGTTATCTGCAGTGG No data
1201719160_1201719162 -5 Left 1201719160 Y:17078188-17078210 CCTGCACAGGGGAGAAACAGAAA No data
Right 1201719162 Y:17078206-17078228 AGAAAGTGTGTGCTGTATAAGGG No data
1201719160_1201719161 -6 Left 1201719160 Y:17078188-17078210 CCTGCACAGGGGAGAAACAGAAA No data
Right 1201719161 Y:17078205-17078227 CAGAAAGTGTGTGCTGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201719160 Original CRISPR TTTCTGTTTCTCCCCTGTGC AGG (reversed) Intergenic