ID: 1201719162

View in Genome Browser
Species Human (GRCh38)
Location Y:17078206-17078228
Sequence AGAAAGTGTGTGCTGTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201719156_1201719162 24 Left 1201719156 Y:17078159-17078181 CCTGCACAGTGGAGACACAGGGA No data
Right 1201719162 Y:17078206-17078228 AGAAAGTGTGTGCTGTATAAGGG No data
1201719160_1201719162 -5 Left 1201719160 Y:17078188-17078210 CCTGCACAGGGGAGAAACAGAAA No data
Right 1201719162 Y:17078206-17078228 AGAAAGTGTGTGCTGTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201719162 Original CRISPR AGAAAGTGTGTGCTGTATAA GGG Intergenic