ID: 1201720473 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:17090723-17090745 |
Sequence | ATGTAGAGATGGAGAGCTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201720473_1201720477 | 2 | Left | 1201720473 | Y:17090723-17090745 | CCATCAGCTCTCCATCTCTACAT | No data | ||
Right | 1201720477 | Y:17090748-17090770 | AAGCCATAAGCGGCCAGGCACGG | No data | ||||
1201720473_1201720476 | -3 | Left | 1201720473 | Y:17090723-17090745 | CCATCAGCTCTCCATCTCTACAT | No data | ||
Right | 1201720476 | Y:17090743-17090765 | CATGAAAGCCATAAGCGGCCAGG | No data | ||||
1201720473_1201720475 | -8 | Left | 1201720473 | Y:17090723-17090745 | CCATCAGCTCTCCATCTCTACAT | No data | ||
Right | 1201720475 | Y:17090738-17090760 | CTCTACATGAAAGCCATAAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201720473 | Original CRISPR | ATGTAGAGATGGAGAGCTGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |