ID: 1201720473

View in Genome Browser
Species Human (GRCh38)
Location Y:17090723-17090745
Sequence ATGTAGAGATGGAGAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201720473_1201720477 2 Left 1201720473 Y:17090723-17090745 CCATCAGCTCTCCATCTCTACAT No data
Right 1201720477 Y:17090748-17090770 AAGCCATAAGCGGCCAGGCACGG No data
1201720473_1201720476 -3 Left 1201720473 Y:17090723-17090745 CCATCAGCTCTCCATCTCTACAT No data
Right 1201720476 Y:17090743-17090765 CATGAAAGCCATAAGCGGCCAGG No data
1201720473_1201720475 -8 Left 1201720473 Y:17090723-17090745 CCATCAGCTCTCCATCTCTACAT No data
Right 1201720475 Y:17090738-17090760 CTCTACATGAAAGCCATAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201720473 Original CRISPR ATGTAGAGATGGAGAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr