ID: 1201721354

View in Genome Browser
Species Human (GRCh38)
Location Y:17101036-17101058
Sequence CTGTAAACTCAGATGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201721354_1201721355 -9 Left 1201721354 Y:17101036-17101058 CCAAGAAGCATCTGAGTTTACAG No data
Right 1201721355 Y:17101050-17101072 AGTTTACAGCCTAAGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201721354 Original CRISPR CTGTAAACTCAGATGCTTCT TGG (reversed) Intergenic
No off target data available for this crispr