ID: 1201724349

View in Genome Browser
Species Human (GRCh38)
Location Y:17136736-17136758
Sequence TAGCATTCAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201724345_1201724349 13 Left 1201724345 Y:17136700-17136722 CCAGAGGGGTTAAAATCAGTGGC No data
Right 1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG No data
1201724341_1201724349 24 Left 1201724341 Y:17136689-17136711 CCCTGCCAGAACCAGAGGGGTTA No data
Right 1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG No data
1201724342_1201724349 23 Left 1201724342 Y:17136690-17136712 CCTGCCAGAACCAGAGGGGTTAA No data
Right 1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG No data
1201724343_1201724349 19 Left 1201724343 Y:17136694-17136716 CCAGAACCAGAGGGGTTAAAATC No data
Right 1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201724349 Original CRISPR TAGCATTCAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr