ID: 1201743145

View in Genome Browser
Species Human (GRCh38)
Location Y:17344600-17344622
Sequence GCACACTTCCCAGCTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201743145_1201743149 5 Left 1201743145 Y:17344600-17344622 CCTGCTTTAGCTGGGAAGTGTGC No data
Right 1201743149 Y:17344628-17344650 GAAGGAGTTTGTAAATAAAAGGG No data
1201743145_1201743155 30 Left 1201743145 Y:17344600-17344622 CCTGCTTTAGCTGGGAAGTGTGC No data
Right 1201743155 Y:17344653-17344675 ATTAGTGATGGGGGTTCCTTTGG No data
1201743145_1201743151 19 Left 1201743145 Y:17344600-17344622 CCTGCTTTAGCTGGGAAGTGTGC No data
Right 1201743151 Y:17344642-17344664 ATAAAAGGGCCATTAGTGATGGG No data
1201743145_1201743150 18 Left 1201743145 Y:17344600-17344622 CCTGCTTTAGCTGGGAAGTGTGC No data
Right 1201743150 Y:17344641-17344663 AATAAAAGGGCCATTAGTGATGG No data
1201743145_1201743148 4 Left 1201743145 Y:17344600-17344622 CCTGCTTTAGCTGGGAAGTGTGC No data
Right 1201743148 Y:17344627-17344649 TGAAGGAGTTTGTAAATAAAAGG No data
1201743145_1201743153 21 Left 1201743145 Y:17344600-17344622 CCTGCTTTAGCTGGGAAGTGTGC No data
Right 1201743153 Y:17344644-17344666 AAAAGGGCCATTAGTGATGGGGG No data
1201743145_1201743152 20 Left 1201743145 Y:17344600-17344622 CCTGCTTTAGCTGGGAAGTGTGC No data
Right 1201743152 Y:17344643-17344665 TAAAAGGGCCATTAGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201743145 Original CRISPR GCACACTTCCCAGCTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr