ID: 1201744567

View in Genome Browser
Species Human (GRCh38)
Location Y:17357625-17357647
Sequence TACCCAGTCCCATCTACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201744567_1201744571 23 Left 1201744567 Y:17357625-17357647 CCAGAAGTAGATGGGACTGGGTA No data
Right 1201744571 Y:17357671-17357693 TCCAAGTGCCATGAAGCAATTGG No data
1201744567_1201744568 -7 Left 1201744567 Y:17357625-17357647 CCAGAAGTAGATGGGACTGGGTA No data
Right 1201744568 Y:17357641-17357663 CTGGGTACCTTTCTATGTACAGG No data
1201744567_1201744569 -6 Left 1201744567 Y:17357625-17357647 CCAGAAGTAGATGGGACTGGGTA No data
Right 1201744569 Y:17357642-17357664 TGGGTACCTTTCTATGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201744567 Original CRISPR TACCCAGTCCCATCTACTTC TGG (reversed) Intergenic
No off target data available for this crispr