ID: 1201755042

View in Genome Browser
Species Human (GRCh38)
Location Y:17478022-17478044
Sequence CACAGCTAAAATGCACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201755042_1201755047 26 Left 1201755042 Y:17478022-17478044 CCAACTTGTGCATTTTAGCTGTG No data
Right 1201755047 Y:17478071-17478093 ATCAATTTCTAGGCAACAGTTGG No data
1201755042_1201755044 -5 Left 1201755042 Y:17478022-17478044 CCAACTTGTGCATTTTAGCTGTG No data
Right 1201755044 Y:17478040-17478062 CTGTGGATTTTATGACAGCTTGG No data
1201755042_1201755045 16 Left 1201755042 Y:17478022-17478044 CCAACTTGTGCATTTTAGCTGTG No data
Right 1201755045 Y:17478061-17478083 GGCCATTATTATCAATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201755042 Original CRISPR CACAGCTAAAATGCACAAGT TGG (reversed) Intergenic
No off target data available for this crispr