ID: 1201755650

View in Genome Browser
Species Human (GRCh38)
Location Y:17483279-17483301
Sequence ACCAAATGAGGCAAGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201755650_1201755660 22 Left 1201755650 Y:17483279-17483301 CCATGTTCCTTGCCTCATTTGGT No data
Right 1201755660 Y:17483324-17483346 GGTATCACTCCACGGTGAACTGG No data
1201755650_1201755657 1 Left 1201755650 Y:17483279-17483301 CCATGTTCCTTGCCTCATTTGGT No data
Right 1201755657 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
1201755650_1201755655 0 Left 1201755650 Y:17483279-17483301 CCATGTTCCTTGCCTCATTTGGT No data
Right 1201755655 Y:17483302-17483324 TCCCAGTTAGGGTTCTCATTTGG No data
1201755650_1201755662 28 Left 1201755650 Y:17483279-17483301 CCATGTTCCTTGCCTCATTTGGT No data
Right 1201755662 Y:17483330-17483352 ACTCCACGGTGAACTGGTGAGGG No data
1201755650_1201755659 14 Left 1201755650 Y:17483279-17483301 CCATGTTCCTTGCCTCATTTGGT No data
Right 1201755659 Y:17483316-17483338 CTCATTTGGGTATCACTCCACGG No data
1201755650_1201755661 27 Left 1201755650 Y:17483279-17483301 CCATGTTCCTTGCCTCATTTGGT No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201755650 Original CRISPR ACCAAATGAGGCAAGGAACA TGG (reversed) Intergenic
No off target data available for this crispr