ID: 1201755651

View in Genome Browser
Species Human (GRCh38)
Location Y:17483286-17483308
Sequence ACTGGGAACCAAATGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201755651_1201755660 15 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755660 Y:17483324-17483346 GGTATCACTCCACGGTGAACTGG No data
1201755651_1201755655 -7 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755655 Y:17483302-17483324 TCCCAGTTAGGGTTCTCATTTGG No data
1201755651_1201755657 -6 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755657 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
1201755651_1201755665 27 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755665 Y:17483336-17483358 CGGTGAACTGGTGAGGGTTAGGG No data
1201755651_1201755664 26 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755664 Y:17483335-17483357 ACGGTGAACTGGTGAGGGTTAGG No data
1201755651_1201755659 7 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755659 Y:17483316-17483338 CTCATTTGGGTATCACTCCACGG No data
1201755651_1201755666 28 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755666 Y:17483337-17483359 GGTGAACTGGTGAGGGTTAGGGG No data
1201755651_1201755661 20 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755651_1201755662 21 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755662 Y:17483330-17483352 ACTCCACGGTGAACTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201755651 Original CRISPR ACTGGGAACCAAATGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr