ID: 1201755653

View in Genome Browser
Species Human (GRCh38)
Location Y:17483291-17483313
Sequence CCCTAACTGGGAACCAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201755653_1201755664 21 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755664 Y:17483335-17483357 ACGGTGAACTGGTGAGGGTTAGG No data
1201755653_1201755665 22 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755665 Y:17483336-17483358 CGGTGAACTGGTGAGGGTTAGGG No data
1201755653_1201755662 16 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755662 Y:17483330-17483352 ACTCCACGGTGAACTGGTGAGGG No data
1201755653_1201755666 23 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755666 Y:17483337-17483359 GGTGAACTGGTGAGGGTTAGGGG No data
1201755653_1201755660 10 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755660 Y:17483324-17483346 GGTATCACTCCACGGTGAACTGG No data
1201755653_1201755661 15 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755653_1201755667 26 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755667 Y:17483340-17483362 GAACTGGTGAGGGTTAGGGGTGG No data
1201755653_1201755659 2 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755659 Y:17483316-17483338 CTCATTTGGGTATCACTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201755653 Original CRISPR CCCTAACTGGGAACCAAATG AGG (reversed) Intergenic
No off target data available for this crispr