ID: 1201755656

View in Genome Browser
Species Human (GRCh38)
Location Y:17483303-17483325
Sequence CCCAAATGAGAACCCTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201755656_1201755659 -10 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755659 Y:17483316-17483338 CTCATTTGGGTATCACTCCACGG No data
1201755656_1201755661 3 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755656_1201755660 -2 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755660 Y:17483324-17483346 GGTATCACTCCACGGTGAACTGG No data
1201755656_1201755669 22 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755669 Y:17483348-17483370 GAGGGTTAGGGGTGGTCTCTGGG No data
1201755656_1201755668 21 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755668 Y:17483347-17483369 TGAGGGTTAGGGGTGGTCTCTGG No data
1201755656_1201755664 9 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755664 Y:17483335-17483357 ACGGTGAACTGGTGAGGGTTAGG No data
1201755656_1201755667 14 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755667 Y:17483340-17483362 GAACTGGTGAGGGTTAGGGGTGG No data
1201755656_1201755666 11 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755666 Y:17483337-17483359 GGTGAACTGGTGAGGGTTAGGGG No data
1201755656_1201755665 10 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755665 Y:17483336-17483358 CGGTGAACTGGTGAGGGTTAGGG No data
1201755656_1201755662 4 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755662 Y:17483330-17483352 ACTCCACGGTGAACTGGTGAGGG No data
1201755656_1201755670 23 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755670 Y:17483349-17483371 AGGGTTAGGGGTGGTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201755656 Original CRISPR CCCAAATGAGAACCCTAACT GGG (reversed) Intergenic
No off target data available for this crispr