ID: 1201755658

View in Genome Browser
Species Human (GRCh38)
Location Y:17483304-17483326
Sequence ACCCAAATGAGAACCCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201755658_1201755670 22 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755670 Y:17483349-17483371 AGGGTTAGGGGTGGTCTCTGGGG No data
1201755658_1201755667 13 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755667 Y:17483340-17483362 GAACTGGTGAGGGTTAGGGGTGG No data
1201755658_1201755665 9 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755665 Y:17483336-17483358 CGGTGAACTGGTGAGGGTTAGGG No data
1201755658_1201755669 21 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755669 Y:17483348-17483370 GAGGGTTAGGGGTGGTCTCTGGG No data
1201755658_1201755668 20 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755668 Y:17483347-17483369 TGAGGGTTAGGGGTGGTCTCTGG No data
1201755658_1201755660 -3 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755660 Y:17483324-17483346 GGTATCACTCCACGGTGAACTGG No data
1201755658_1201755662 3 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755662 Y:17483330-17483352 ACTCCACGGTGAACTGGTGAGGG No data
1201755658_1201755666 10 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755666 Y:17483337-17483359 GGTGAACTGGTGAGGGTTAGGGG No data
1201755658_1201755661 2 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755658_1201755664 8 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755664 Y:17483335-17483357 ACGGTGAACTGGTGAGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201755658 Original CRISPR ACCCAAATGAGAACCCTAAC TGG (reversed) Intergenic
No off target data available for this crispr