ID: 1201755661

View in Genome Browser
Species Human (GRCh38)
Location Y:17483329-17483351
Sequence CACTCCACGGTGAACTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201755653_1201755661 15 Left 1201755653 Y:17483291-17483313 CCTCATTTGGTTCCCAGTTAGGG No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755650_1201755661 27 Left 1201755650 Y:17483279-17483301 CCATGTTCCTTGCCTCATTTGGT No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755656_1201755661 3 Left 1201755656 Y:17483303-17483325 CCCAGTTAGGGTTCTCATTTGGG No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755658_1201755661 2 Left 1201755658 Y:17483304-17483326 CCAGTTAGGGTTCTCATTTGGGT No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data
1201755651_1201755661 20 Left 1201755651 Y:17483286-17483308 CCTTGCCTCATTTGGTTCCCAGT No data
Right 1201755661 Y:17483329-17483351 CACTCCACGGTGAACTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201755661 Original CRISPR CACTCCACGGTGAACTGGTG AGG Intergenic
No off target data available for this crispr