ID: 1201756750

View in Genome Browser
Species Human (GRCh38)
Location Y:17494456-17494478
Sequence TGGGCAAGACCTCCCAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201756741_1201756750 -1 Left 1201756741 Y:17494434-17494456 CCCTGATCCTGTTCCTCCTGACT 0: 30
1: 70
2: 143
3: 212
4: 612
Right 1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG No data
1201756740_1201756750 21 Left 1201756740 Y:17494412-17494434 CCAGACTGCTTCTTTAAGCAGTC No data
Right 1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG No data
1201756745_1201756750 -8 Left 1201756745 Y:17494441-17494463 CCTGTTCCTCCTGACTGGGCAAG No data
Right 1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG No data
1201756742_1201756750 -2 Left 1201756742 Y:17494435-17494457 CCTGATCCTGTTCCTCCTGACTG 0: 29
1: 75
2: 164
3: 242
4: 628
Right 1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201756750 Original CRISPR TGGGCAAGACCTCCCAAAAG GGG Intergenic
No off target data available for this crispr