ID: 1201758972

View in Genome Browser
Species Human (GRCh38)
Location Y:17517916-17517938
Sequence ACCACTGATGACCATACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201758972_1201758976 18 Left 1201758972 Y:17517916-17517938 CCAGGTGTATGGTCATCAGTGGT No data
Right 1201758976 Y:17517957-17517979 TGGACCAAGTGTCACATGTGAGG No data
1201758972_1201758973 -2 Left 1201758972 Y:17517916-17517938 CCAGGTGTATGGTCATCAGTGGT No data
Right 1201758973 Y:17517937-17517959 GTCACCACCACAATGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201758972 Original CRISPR ACCACTGATGACCATACACC TGG (reversed) Intergenic
No off target data available for this crispr