ID: 1201759708

View in Genome Browser
Species Human (GRCh38)
Location Y:17523399-17523421
Sequence TAAGGGGGCTGCCTCTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201759695_1201759708 8 Left 1201759695 Y:17523368-17523390 CCTTCTCACTTCCTCTGTGACGG No data
Right 1201759708 Y:17523399-17523421 TAAGGGGGCTGCCTCTGAAGGGG No data
1201759700_1201759708 -3 Left 1201759700 Y:17523379-17523401 CCTCTGTGACGGCCAGGGGTTAA No data
Right 1201759708 Y:17523399-17523421 TAAGGGGGCTGCCTCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201759708 Original CRISPR TAAGGGGGCTGCCTCTGAAG GGG Intergenic
No off target data available for this crispr