ID: 1201760901

View in Genome Browser
Species Human (GRCh38)
Location Y:17537086-17537108
Sequence AGGAAGAGCACAATGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201760901_1201760910 27 Left 1201760901 Y:17537086-17537108 CCTTCAGTCATTGTGCTCTTCCT No data
Right 1201760910 Y:17537136-17537158 TGTGTGGCTGCTGCTGGGTGGGG No data
1201760901_1201760911 28 Left 1201760901 Y:17537086-17537108 CCTTCAGTCATTGTGCTCTTCCT No data
Right 1201760911 Y:17537137-17537159 GTGTGGCTGCTGCTGGGTGGGGG No data
1201760901_1201760905 11 Left 1201760901 Y:17537086-17537108 CCTTCAGTCATTGTGCTCTTCCT No data
Right 1201760905 Y:17537120-17537142 ACAAGTTTCTCTGTGCTGTGTGG No data
1201760901_1201760906 21 Left 1201760901 Y:17537086-17537108 CCTTCAGTCATTGTGCTCTTCCT No data
Right 1201760906 Y:17537130-17537152 CTGTGCTGTGTGGCTGCTGCTGG No data
1201760901_1201760908 25 Left 1201760901 Y:17537086-17537108 CCTTCAGTCATTGTGCTCTTCCT No data
Right 1201760908 Y:17537134-17537156 GCTGTGTGGCTGCTGCTGGGTGG No data
1201760901_1201760907 22 Left 1201760901 Y:17537086-17537108 CCTTCAGTCATTGTGCTCTTCCT No data
Right 1201760907 Y:17537131-17537153 TGTGCTGTGTGGCTGCTGCTGGG No data
1201760901_1201760909 26 Left 1201760901 Y:17537086-17537108 CCTTCAGTCATTGTGCTCTTCCT No data
Right 1201760909 Y:17537135-17537157 CTGTGTGGCTGCTGCTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201760901 Original CRISPR AGGAAGAGCACAATGACTGA AGG (reversed) Intergenic
No off target data available for this crispr