ID: 1201760937

View in Genome Browser
Species Human (GRCh38)
Location Y:17537331-17537353
Sequence CACATGAGTCGAAGAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201760937_1201760941 18 Left 1201760937 Y:17537331-17537353 CCAATAGCTCTTCGACTCATGTG No data
Right 1201760941 Y:17537372-17537394 CAAGCTCCCAACATTGAGATGGG No data
1201760937_1201760940 17 Left 1201760937 Y:17537331-17537353 CCAATAGCTCTTCGACTCATGTG No data
Right 1201760940 Y:17537371-17537393 TCAAGCTCCCAACATTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201760937 Original CRISPR CACATGAGTCGAAGAGCTAT TGG (reversed) Intergenic
No off target data available for this crispr