ID: 1201763356

View in Genome Browser
Species Human (GRCh38)
Location Y:17560609-17560631
Sequence TTGTGTGTCTCGCCCTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201763349_1201763356 3 Left 1201763349 Y:17560583-17560605 CCTGGAGTCCCTGTCTTGCACAA No data
Right 1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG No data
1201763352_1201763356 -6 Left 1201763352 Y:17560592-17560614 CCTGTCTTGCACAAAGGTTGTGT No data
Right 1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG No data
1201763351_1201763356 -5 Left 1201763351 Y:17560591-17560613 CCCTGTCTTGCACAAAGGTTGTG No data
Right 1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG No data
1201763346_1201763356 23 Left 1201763346 Y:17560563-17560585 CCTGCGGCGGGCTGGGGGGCCCT No data
Right 1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG No data
1201763345_1201763356 24 Left 1201763345 Y:17560562-17560584 CCCTGCGGCGGGCTGGGGGGCCC No data
Right 1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG No data
1201763348_1201763356 4 Left 1201763348 Y:17560582-17560604 CCCTGGAGTCCCTGTCTTGCACA No data
Right 1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG No data
1201763344_1201763356 25 Left 1201763344 Y:17560561-17560583 CCCCTGCGGCGGGCTGGGGGGCC No data
Right 1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201763356 Original CRISPR TTGTGTGTCTCGCCCTCAGG GGG Intergenic
No off target data available for this crispr