ID: 1201763450

View in Genome Browser
Species Human (GRCh38)
Location Y:17560967-17560989
Sequence GCCTCGAGGTTGTTTTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201763438_1201763450 27 Left 1201763438 Y:17560917-17560939 CCCGGCGCAGGGGCCGCCAGGAA No data
Right 1201763450 Y:17560967-17560989 GCCTCGAGGTTGTTTTCCCCGGG No data
1201763441_1201763450 14 Left 1201763441 Y:17560930-17560952 CCGCCAGGAAGGCACTGTCGTCC No data
Right 1201763450 Y:17560967-17560989 GCCTCGAGGTTGTTTTCCCCGGG No data
1201763445_1201763450 -7 Left 1201763445 Y:17560951-17560973 CCGTGGGAGAATCCCAGCCTCGA No data
Right 1201763450 Y:17560967-17560989 GCCTCGAGGTTGTTTTCCCCGGG No data
1201763439_1201763450 26 Left 1201763439 Y:17560918-17560940 CCGGCGCAGGGGCCGCCAGGAAG No data
Right 1201763450 Y:17560967-17560989 GCCTCGAGGTTGTTTTCCCCGGG No data
1201763442_1201763450 11 Left 1201763442 Y:17560933-17560955 CCAGGAAGGCACTGTCGTCCGTG No data
Right 1201763450 Y:17560967-17560989 GCCTCGAGGTTGTTTTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201763450 Original CRISPR GCCTCGAGGTTGTTTTCCCC GGG Intergenic