ID: 1201763765

View in Genome Browser
Species Human (GRCh38)
Location Y:17562243-17562265
Sequence GTGTGCATCTCGCCCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201763765_1201763767 -5 Left 1201763765 Y:17562243-17562265 CCTCCTGAGGGCGAGATGCACAC No data
Right 1201763767 Y:17562261-17562283 CACACTCTTGAGTACAAGCCAGG No data
1201763765_1201763768 -4 Left 1201763765 Y:17562243-17562265 CCTCCTGAGGGCGAGATGCACAC No data
Right 1201763768 Y:17562262-17562284 ACACTCTTGAGTACAAGCCAGGG No data
1201763765_1201763771 20 Left 1201763765 Y:17562243-17562265 CCTCCTGAGGGCGAGATGCACAC No data
Right 1201763771 Y:17562286-17562308 CTCTACGACACCGCCAGGACCGG No data
1201763765_1201763772 26 Left 1201763765 Y:17562243-17562265 CCTCCTGAGGGCGAGATGCACAC No data
Right 1201763772 Y:17562292-17562314 GACACCGCCAGGACCGGCGCAGG No data
1201763765_1201763773 27 Left 1201763765 Y:17562243-17562265 CCTCCTGAGGGCGAGATGCACAC No data
Right 1201763773 Y:17562293-17562315 ACACCGCCAGGACCGGCGCAGGG No data
1201763765_1201763770 15 Left 1201763765 Y:17562243-17562265 CCTCCTGAGGGCGAGATGCACAC No data
Right 1201763770 Y:17562281-17562303 AGGGACTCTACGACACCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201763765 Original CRISPR GTGTGCATCTCGCCCTCAGG AGG (reversed) Intergenic
No off target data available for this crispr