ID: 1201764849

View in Genome Browser
Species Human (GRCh38)
Location Y:17566877-17566899
Sequence GCAGCCCCTGTGTTGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201764849_1201764857 11 Left 1201764849 Y:17566877-17566899 CCCGGCCCCAACACAGGGGCTGC No data
Right 1201764857 Y:17566911-17566933 TGCCATCTGTTGAACGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201764849 Original CRISPR GCAGCCCCTGTGTTGGGGCC GGG (reversed) Intergenic