ID: 1201765801

View in Genome Browser
Species Human (GRCh38)
Location Y:17572653-17572675
Sequence GGTTATCTGCAGATAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201765801_1201765804 3 Left 1201765801 Y:17572653-17572675 CCTGCCATTATCTGCAGATAACC No data
Right 1201765804 Y:17572679-17572701 CTTTCTATCCAGCTAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201765801 Original CRISPR GGTTATCTGCAGATAATGGC AGG (reversed) Intergenic
No off target data available for this crispr