ID: 1201770647

View in Genome Browser
Species Human (GRCh38)
Location Y:17614347-17614369
Sequence ACCAGGGCAGAGAGGGTCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201770647_1201770653 1 Left 1201770647 Y:17614347-17614369 CCTACGACCCTCTCTGCCCTGGT No data
Right 1201770653 Y:17614371-17614393 TTTCTGGTAGTTTTCACCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201770647 Original CRISPR ACCAGGGCAGAGAGGGTCGT AGG (reversed) Intergenic
No off target data available for this crispr