ID: 1201770877

View in Genome Browser
Species Human (GRCh38)
Location Y:17615622-17615644
Sequence CCATGGCACATGTAAACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201770877_1201770882 14 Left 1201770877 Y:17615622-17615644 CCATAGGTTTACATGTGCCATGG No data
Right 1201770882 Y:17615659-17615681 TATCTCAAACTCCCGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201770877 Original CRISPR CCATGGCACATGTAAACCTA TGG (reversed) Intergenic
No off target data available for this crispr