ID: 1201770978

View in Genome Browser
Species Human (GRCh38)
Location Y:17616584-17616606
Sequence CCTGATAAGCTGGGATTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201770971_1201770978 8 Left 1201770971 Y:17616553-17616575 CCAGCTTCAAGTGATTCTCCTGC 0: 308
1: 37154
2: 85720
3: 104428
4: 125021
Right 1201770978 Y:17616584-17616606 CCTGATAAGCTGGGATTACAGGG No data
1201770970_1201770978 9 Left 1201770970 Y:17616552-17616574 CCCAGCTTCAAGTGATTCTCCTG 0: 165
1: 22061
2: 87419
3: 151117
4: 181551
Right 1201770978 Y:17616584-17616606 CCTGATAAGCTGGGATTACAGGG No data
1201770972_1201770978 -10 Left 1201770972 Y:17616571-17616593 CCTGCCTCAACATCCTGATAAGC No data
Right 1201770978 Y:17616584-17616606 CCTGATAAGCTGGGATTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201770978 Original CRISPR CCTGATAAGCTGGGATTACA GGG Intergenic
No off target data available for this crispr