ID: 1201771100

View in Genome Browser
Species Human (GRCh38)
Location Y:17617768-17617790
Sequence TCTTGGGTGAACAGGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201771096_1201771100 -4 Left 1201771096 Y:17617749-17617771 CCATTTTTGCTTAGGATTGTCTT No data
Right 1201771100 Y:17617768-17617790 TCTTGGGTGAACAGGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201771100 Original CRISPR TCTTGGGTGAACAGGCAAAC AGG Intergenic
No off target data available for this crispr