ID: 1201776455

View in Genome Browser
Species Human (GRCh38)
Location Y:17671196-17671218
Sequence CAATATCTGGCACCCAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201776455_1201776469 23 Left 1201776455 Y:17671196-17671218 CCTGCGTTGGGTGCCAGATATTG No data
Right 1201776469 Y:17671242-17671264 AGTGGGTACACTGACTCTGGTGG No data
1201776455_1201776467 20 Left 1201776455 Y:17671196-17671218 CCTGCGTTGGGTGCCAGATATTG No data
Right 1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG No data
1201776455_1201776462 6 Left 1201776455 Y:17671196-17671218 CCTGCGTTGGGTGCCAGATATTG No data
Right 1201776462 Y:17671225-17671247 CCAGCCCCGCACTACCCAGTGGG No data
1201776455_1201776460 5 Left 1201776455 Y:17671196-17671218 CCTGCGTTGGGTGCCAGATATTG No data
Right 1201776460 Y:17671224-17671246 ACCAGCCCCGCACTACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201776455 Original CRISPR CAATATCTGGCACCCAACGC AGG (reversed) Intergenic