ID: 1201776461

View in Genome Browser
Species Human (GRCh38)
Location Y:17671225-17671247
Sequence CCCACTGGGTAGTGCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201776461_1201776467 -9 Left 1201776461 Y:17671225-17671247 CCAGCCCCGCACTACCCAGTGGG No data
Right 1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG No data
1201776461_1201776469 -6 Left 1201776461 Y:17671225-17671247 CCAGCCCCGCACTACCCAGTGGG No data
Right 1201776469 Y:17671242-17671264 AGTGGGTACACTGACTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201776461 Original CRISPR CCCACTGGGTAGTGCGGGGC TGG (reversed) Intergenic