ID: 1201776467

View in Genome Browser
Species Human (GRCh38)
Location Y:17671239-17671261
Sequence CCCAGTGGGTACACTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201776459_1201776467 7 Left 1201776459 Y:17671209-17671231 CCAGATATTGGGGAAACCAGCCC No data
Right 1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG No data
1201776461_1201776467 -9 Left 1201776461 Y:17671225-17671247 CCAGCCCCGCACTACCCAGTGGG No data
Right 1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG No data
1201776455_1201776467 20 Left 1201776455 Y:17671196-17671218 CCTGCGTTGGGTGCCAGATATTG No data
Right 1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201776467 Original CRISPR CCCAGTGGGTACACTGACTC TGG Intergenic