ID: 1201783215

View in Genome Browser
Species Human (GRCh38)
Location Y:17745357-17745379
Sequence CCCAGTGGGTACCCTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201783215_1201783223 12 Left 1201783215 Y:17745357-17745379 CCAGACTCAGGGTACCCACTGGG No data
Right 1201783223 Y:17745392-17745414 GGTTTCCCCAACACTAACCTCGG 0: 8
1: 0
2: 0
3: 11
4: 121
1201783215_1201783221 -9 Left 1201783215 Y:17745357-17745379 CCAGACTCAGGGTACCCACTGGG No data
Right 1201783221 Y:17745371-17745393 CCCACTGGGTGGTGTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201783215 Original CRISPR CCCAGTGGGTACCCTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr