ID: 1201788334

View in Genome Browser
Species Human (GRCh38)
Location Y:17809219-17809241
Sequence CTTCCTGTTCTGAAGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201788334_1201788339 5 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788339 Y:17809247-17809269 ACTTTGTAGGTCTCCAGGAGGGG No data
1201788334_1201788335 -8 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788335 Y:17809234-17809256 ACAGGAAGACTGTACTTTGTAGG No data
1201788334_1201788342 14 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788342 Y:17809256-17809278 GTCTCCAGGAGGGGCAGGATGGG No data
1201788334_1201788340 9 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788340 Y:17809251-17809273 TGTAGGTCTCCAGGAGGGGCAGG No data
1201788334_1201788341 13 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788341 Y:17809255-17809277 GGTCTCCAGGAGGGGCAGGATGG No data
1201788334_1201788336 0 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788336 Y:17809242-17809264 ACTGTACTTTGTAGGTCTCCAGG No data
1201788334_1201788338 4 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788338 Y:17809246-17809268 TACTTTGTAGGTCTCCAGGAGGG No data
1201788334_1201788344 22 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788344 Y:17809264-17809286 GAGGGGCAGGATGGGATATGAGG No data
1201788334_1201788337 3 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788337 Y:17809245-17809267 GTACTTTGTAGGTCTCCAGGAGG No data
1201788334_1201788345 23 Left 1201788334 Y:17809219-17809241 CCATGTATCTTCAGAACAGGAAG No data
Right 1201788345 Y:17809265-17809287 AGGGGCAGGATGGGATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201788334 Original CRISPR CTTCCTGTTCTGAAGATACA TGG (reversed) Intergenic
No off target data available for this crispr