ID: 1201796633

View in Genome Browser
Species Human (GRCh38)
Location Y:17903443-17903465
Sequence AGTTATCTGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201796625_1201796633 25 Left 1201796625 Y:17903395-17903417 CCACCAAAGCCCAGCAATGGGCC No data
Right 1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG No data
1201796630_1201796633 4 Left 1201796630 Y:17903416-17903438 CCAGGAGCTGTCTCTCCAAAGAA No data
Right 1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG No data
1201796629_1201796633 15 Left 1201796629 Y:17903405-17903427 CCAGCAATGGGCCAGGAGCTGTC No data
Right 1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG No data
1201796628_1201796633 16 Left 1201796628 Y:17903404-17903426 CCCAGCAATGGGCCAGGAGCTGT No data
Right 1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG No data
1201796626_1201796633 22 Left 1201796626 Y:17903398-17903420 CCAAAGCCCAGCAATGGGCCAGG No data
Right 1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201796633 Original CRISPR AGTTATCTGCAGAAAATGGC AGG Intergenic
No off target data available for this crispr