ID: 1201796915

View in Genome Browser
Species Human (GRCh38)
Location Y:17905917-17905939
Sequence GCTTTCAGCAGAGACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201796915_1201796920 -9 Left 1201796915 Y:17905917-17905939 CCACCACAGTCTCTGCTGAAAGC No data
Right 1201796920 Y:17905931-17905953 GCTGAAAGCTGGGGAGATAATGG No data
1201796915_1201796925 28 Left 1201796915 Y:17905917-17905939 CCACCACAGTCTCTGCTGAAAGC No data
Right 1201796925 Y:17905968-17905990 GTGAGGAGCTACCCACTCGAGGG No data
1201796915_1201796922 11 Left 1201796915 Y:17905917-17905939 CCACCACAGTCTCTGCTGAAAGC No data
Right 1201796922 Y:17905951-17905973 TGGGATGACCAGCTAGAGTGAGG No data
1201796915_1201796924 27 Left 1201796915 Y:17905917-17905939 CCACCACAGTCTCTGCTGAAAGC No data
Right 1201796924 Y:17905967-17905989 AGTGAGGAGCTACCCACTCGAGG No data
1201796915_1201796921 -8 Left 1201796915 Y:17905917-17905939 CCACCACAGTCTCTGCTGAAAGC No data
Right 1201796921 Y:17905932-17905954 CTGAAAGCTGGGGAGATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201796915 Original CRISPR GCTTTCAGCAGAGACTGTGG TGG (reversed) Intergenic
No off target data available for this crispr