ID: 1201796916

View in Genome Browser
Species Human (GRCh38)
Location Y:17905920-17905942
Sequence CCAGCTTTCAGCAGAGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201796916_1201796924 24 Left 1201796916 Y:17905920-17905942 CCACAGTCTCTGCTGAAAGCTGG No data
Right 1201796924 Y:17905967-17905989 AGTGAGGAGCTACCCACTCGAGG No data
1201796916_1201796922 8 Left 1201796916 Y:17905920-17905942 CCACAGTCTCTGCTGAAAGCTGG No data
Right 1201796922 Y:17905951-17905973 TGGGATGACCAGCTAGAGTGAGG No data
1201796916_1201796925 25 Left 1201796916 Y:17905920-17905942 CCACAGTCTCTGCTGAAAGCTGG No data
Right 1201796925 Y:17905968-17905990 GTGAGGAGCTACCCACTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201796916 Original CRISPR CCAGCTTTCAGCAGAGACTG TGG (reversed) Intergenic
No off target data available for this crispr