ID: 1201796922 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:17905951-17905973 |
| Sequence | TGGGATGACCAGCTAGAGTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201796914_1201796922 | 12 | Left | 1201796914 | Y:17905916-17905938 | CCCACCACAGTCTCTGCTGAAAG | No data | ||
| Right | 1201796922 | Y:17905951-17905973 | TGGGATGACCAGCTAGAGTGAGG | No data | ||||
| 1201796915_1201796922 | 11 | Left | 1201796915 | Y:17905917-17905939 | CCACCACAGTCTCTGCTGAAAGC | No data | ||
| Right | 1201796922 | Y:17905951-17905973 | TGGGATGACCAGCTAGAGTGAGG | No data | ||||
| 1201796916_1201796922 | 8 | Left | 1201796916 | Y:17905920-17905942 | CCACAGTCTCTGCTGAAAGCTGG | No data | ||
| Right | 1201796922 | Y:17905951-17905973 | TGGGATGACCAGCTAGAGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201796922 | Original CRISPR | TGGGATGACCAGCTAGAGTG AGG | Intergenic | ||
| No off target data available for this crispr | |||||