ID: 1201796922

View in Genome Browser
Species Human (GRCh38)
Location Y:17905951-17905973
Sequence TGGGATGACCAGCTAGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201796914_1201796922 12 Left 1201796914 Y:17905916-17905938 CCCACCACAGTCTCTGCTGAAAG No data
Right 1201796922 Y:17905951-17905973 TGGGATGACCAGCTAGAGTGAGG No data
1201796915_1201796922 11 Left 1201796915 Y:17905917-17905939 CCACCACAGTCTCTGCTGAAAGC No data
Right 1201796922 Y:17905951-17905973 TGGGATGACCAGCTAGAGTGAGG No data
1201796916_1201796922 8 Left 1201796916 Y:17905920-17905942 CCACAGTCTCTGCTGAAAGCTGG No data
Right 1201796922 Y:17905951-17905973 TGGGATGACCAGCTAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201796922 Original CRISPR TGGGATGACCAGCTAGAGTG AGG Intergenic
No off target data available for this crispr