ID: 1201796922 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:17905951-17905973 |
Sequence | TGGGATGACCAGCTAGAGTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201796914_1201796922 | 12 | Left | 1201796914 | Y:17905916-17905938 | CCCACCACAGTCTCTGCTGAAAG | No data | ||
Right | 1201796922 | Y:17905951-17905973 | TGGGATGACCAGCTAGAGTGAGG | No data | ||||
1201796916_1201796922 | 8 | Left | 1201796916 | Y:17905920-17905942 | CCACAGTCTCTGCTGAAAGCTGG | No data | ||
Right | 1201796922 | Y:17905951-17905973 | TGGGATGACCAGCTAGAGTGAGG | No data | ||||
1201796915_1201796922 | 11 | Left | 1201796915 | Y:17905917-17905939 | CCACCACAGTCTCTGCTGAAAGC | No data | ||
Right | 1201796922 | Y:17905951-17905973 | TGGGATGACCAGCTAGAGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201796922 | Original CRISPR | TGGGATGACCAGCTAGAGTG AGG | Intergenic | ||