ID: 1201796925

View in Genome Browser
Species Human (GRCh38)
Location Y:17905968-17905990
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201796916_1201796925 25 Left 1201796916 Y:17905920-17905942 CCACAGTCTCTGCTGAAAGCTGG No data
Right 1201796925 Y:17905968-17905990 GTGAGGAGCTACCCACTCGAGGG No data
1201796915_1201796925 28 Left 1201796915 Y:17905917-17905939 CCACCACAGTCTCTGCTGAAAGC No data
Right 1201796925 Y:17905968-17905990 GTGAGGAGCTACCCACTCGAGGG No data
1201796914_1201796925 29 Left 1201796914 Y:17905916-17905938 CCCACCACAGTCTCTGCTGAAAG No data
Right 1201796925 Y:17905968-17905990 GTGAGGAGCTACCCACTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201796925 Original CRISPR GTGAGGAGCTACCCACTCGA GGG Intergenic