ID: 1201804638

View in Genome Browser
Species Human (GRCh38)
Location Y:18000068-18000090
Sequence GCTTTCAGCAGAGACTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201804631_1201804638 11 Left 1201804631 Y:18000034-18000056 CCTCACTCTAGCTGGTCATCCCA No data
Right 1201804638 Y:18000068-18000090 GCTTTCAGCAGAGACTGTGGTGG No data
1201804628_1201804638 28 Left 1201804628 Y:18000017-18000039 CCCTCGAGTGGGTAGCTCCTCAC No data
Right 1201804638 Y:18000068-18000090 GCTTTCAGCAGAGACTGTGGTGG No data
1201804632_1201804638 -8 Left 1201804632 Y:18000053-18000075 CCCATTATCTCCCCAGCTTTCAG No data
Right 1201804638 Y:18000068-18000090 GCTTTCAGCAGAGACTGTGGTGG No data
1201804633_1201804638 -9 Left 1201804633 Y:18000054-18000076 CCATTATCTCCCCAGCTTTCAGC No data
Right 1201804638 Y:18000068-18000090 GCTTTCAGCAGAGACTGTGGTGG No data
1201804629_1201804638 27 Left 1201804629 Y:18000018-18000040 CCTCGAGTGGGTAGCTCCTCACT No data
Right 1201804638 Y:18000068-18000090 GCTTTCAGCAGAGACTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201804638 Original CRISPR GCTTTCAGCAGAGACTGTGG TGG Intergenic
No off target data available for this crispr