ID: 1201804922

View in Genome Browser
Species Human (GRCh38)
Location Y:18002542-18002564
Sequence AGTTATCTGCAGAAAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201804922_1201804927 16 Left 1201804922 Y:18002542-18002564 CCTGCCATTTTCTGCAGATAACT No data
Right 1201804927 Y:18002581-18002603 ACAGCTCCTGGCCCATTGCTGGG No data
1201804922_1201804926 15 Left 1201804922 Y:18002542-18002564 CCTGCCATTTTCTGCAGATAACT No data
Right 1201804926 Y:18002580-18002602 GACAGCTCCTGGCCCATTGCTGG No data
1201804922_1201804930 25 Left 1201804922 Y:18002542-18002564 CCTGCCATTTTCTGCAGATAACT No data
Right 1201804930 Y:18002590-18002612 GGCCCATTGCTGGGCTTTGGTGG No data
1201804922_1201804929 22 Left 1201804922 Y:18002542-18002564 CCTGCCATTTTCTGCAGATAACT No data
Right 1201804929 Y:18002587-18002609 CCTGGCCCATTGCTGGGCTTTGG No data
1201804922_1201804925 4 Left 1201804922 Y:18002542-18002564 CCTGCCATTTTCTGCAGATAACT No data
Right 1201804925 Y:18002569-18002591 TTCTTTGGAGAGACAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201804922 Original CRISPR AGTTATCTGCAGAAAATGGC AGG (reversed) Intergenic
No off target data available for this crispr