ID: 1201813219

View in Genome Browser
Species Human (GRCh38)
Location Y:18096769-18096791
Sequence CTTCCTGTTCTGAAGATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201813212_1201813219 13 Left 1201813212 Y:18096733-18096755 CCATCCTGCCCCTCCTGGAGACC No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813214_1201813219 5 Left 1201813214 Y:18096741-18096763 CCCCTCCTGGAGACCTACAAAGT No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813215_1201813219 4 Left 1201813215 Y:18096742-18096764 CCCTCCTGGAGACCTACAAAGTA No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813209_1201813219 22 Left 1201813209 Y:18096724-18096746 CCTCATATCCCATCCTGCCCCTC No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813218_1201813219 -8 Left 1201813218 Y:18096754-18096776 CCTACAAAGTACAGTCTTCCTGT No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813213_1201813219 9 Left 1201813213 Y:18096737-18096759 CCTGCCCCTCCTGGAGACCTACA No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813208_1201813219 23 Left 1201813208 Y:18096723-18096745 CCCTCATATCCCATCCTGCCCCT No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813216_1201813219 3 Left 1201813216 Y:18096743-18096765 CCTCCTGGAGACCTACAAAGTAC No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813211_1201813219 14 Left 1201813211 Y:18096732-18096754 CCCATCCTGCCCCTCCTGGAGAC No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data
1201813217_1201813219 0 Left 1201813217 Y:18096746-18096768 CCTGGAGACCTACAAAGTACAGT No data
Right 1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201813219 Original CRISPR CTTCCTGTTCTGAAGATACA TGG Intergenic
No off target data available for this crispr