ID: 1201818338

View in Genome Browser
Species Human (GRCh38)
Location Y:18160630-18160652
Sequence CCCAGTGGGTACCCTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201818332_1201818338 -9 Left 1201818332 Y:18160616-18160638 CCAGTCCCACACCACCCAGTGGG No data
Right 1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG No data
1201818330_1201818338 12 Left 1201818330 Y:18160595-18160617 CCGAGGTTAGTGTTGGGGAAACC 0: 8
1: 0
2: 0
3: 11
4: 121
Right 1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201818338 Original CRISPR CCCAGTGGGTACCCTGAGTC TGG Intergenic
No off target data available for this crispr