ID: 1201818704

View in Genome Browser
Species Human (GRCh38)
Location Y:18163476-18163498
Sequence GTGAATTCCCATACATGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201818701_1201818704 29 Left 1201818701 Y:18163424-18163446 CCAATACAATAGAATCTTGTGAC No data
Right 1201818704 Y:18163476-18163498 GTGAATTCCCATACATGTCTTGG No data
1201818703_1201818704 3 Left 1201818703 Y:18163450-18163472 CCTCTTGTAGGAAGTATATTAGT No data
Right 1201818704 Y:18163476-18163498 GTGAATTCCCATACATGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201818704 Original CRISPR GTGAATTCCCATACATGTCT TGG Intergenic
No off target data available for this crispr