ID: 1201818756

View in Genome Browser
Species Human (GRCh38)
Location Y:18164031-18164053
Sequence CTGCTTGAGCAGAGGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201818752_1201818756 8 Left 1201818752 Y:18164000-18164022 CCGAGACTATAGGGAGCATGCAT No data
Right 1201818756 Y:18164031-18164053 CTGCTTGAGCAGAGGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201818756 Original CRISPR CTGCTTGAGCAGAGGTCATG GGG Intergenic
No off target data available for this crispr